Results of your search


Your query was

a gift of

Here is a random selection of 50 solutions from the 110 found.

A7G 276 So a gift of, say £20, will become £26.67 at no added cost to you.

A9J 65 In general, our policy should be to proceed with building our state block by block, without waiting to be given a gift of it through negotiations.

ADC 126 At Corinth St Paul found the phenomenon deeply divisive and productive of censoriousness; he taught the Corinthian church that the authenticity of a gift of the Spirit should be tested by whether or not it contributed to love and edification of the community as a whole.

ADC 305 The ‘world’ was, in terms of nature and by creation, a great good, a gift of the omnipotent and good Creator.

AMT 176 Whereas works were human actions, faith was a gift of grace, a divine action, something implanted in the believer by God — the sort of imagery that Barth refined in his work on Anselm.

AN0 180 Only when Polish intelligence made a gift of its work to GCCS in August 1939 was it able to break its first German messages.

AND 798 A family service guaranteed to pack the school hall is a mothers' day assembly particularly if mums, including teachers, receive a gift of a small posy of spring flowers.

ANF 1140 Ehrenburg was convinced that Modi had a gift of prophecy.

ARR 965 On her unlucky nights she really would benefit enormously from a gift of blood.

AYR 442 And as an added incentive you could receive a gift of your choice absolutely free regardless of which savings option you select, if you apply before the 26th July, 1991.

BPF 199 A Gift of Love

C8Y 1048 Like all prisoners of circumstance, you will probably reflect a good deal on the whole subject of ‘time’ and of its strange habits of hanging, dragging, or running out too quickly, but if you decide to use and dominate it, instead of allowing it to dominate you, you will inevitably come to the conclusion that it is only wasted if it is thrown away, never when it is offered freely, as a gift of love.

C93 1367 The vicarage was a gift of the Archbishop of York and was built 1869/70.

C9S 1250 who believed that ‘human sexuality in all its richness is a gift of God gladly to be accepted, enjoyed and honoured, as a way of both expressing and growing in love, in accordance with the life and teaching of Jesus Christ.’

CAC 310 This happened when a gift of clothes was left for one brownie, who cried:

CBW 3639 The gift of shares was treated as being a transfer of value of the relevant part of the settled property, and therefore no exemption was available as a gift of property to a charity in accordance with para 15(3) (ba), Sch 6, FA 1975, according to the Chancery Division of the High Court in Powell-Cotton v IRC [1992]STI 663.

CCN 1815 A gift of story-telling.

CG3 1604 Your task is to write a gift of laughter for your friend.

CH2 2189 But a spokesman said last night: ‘A gift of £1 million has also been received from the Emir of Kuwait.

CH7 2133 England No 2 Laurie McMenemy arrived late and missed the Corky and Ferdinand goals — but he saw Deane spurn a gift of an equaliser before finally striking with a header.

CK5 3052 And he's blessed with a gift of a voice that swoops from arcs of strangulated screeching to the huskiest falsetto.

CKT 438 Michael Ward Stout, President of the Robert Mapplethorpe Foundation, says that the ‘permanent association’ with the Solomon R. Guggenheim Foundation will begin with a gift of $2 million in cash and more than 200 of Mapplethorpe's finest photographs and ‘unique objects’, to form the nucleus of an eventual collection of major modern and contemporary photography.

CRR 494 Political intervention was advisable even when an applicant had the necessary financial strength to make a purchase, and if a gift of a commission was a greater compliment, permission to purchase was nonetheless gratefully accepted.

CS7 901 This took the form of a gift of the proceeds from the sale of a hospital farm.

EDN 649 She must have that quality, without which no woman could meet his exacting standard, a gift of caring and nurturing, a loving, maternal sweetness.

EEW 2016 But I would consider it a great honour and privilege if you would allow me to help you overcome this disadvantage by making you a gift of whatever you may need.’

EW9 1138 A gift of £250 from Sir Alan's will went towards the making of tennis courts, and in due course a Trust Fund was established, of which the School has been a great beneficiary over the years.

FNX 1315 On the allotted day, he and Joan arrived at the office for a ten-o'clock wedding, carrying with them a gift of two enormous chairs of the type popular with minor African potentates.

FPN 26 He had a mind of quicksilver and a gift of repartee that was second nature; his special love of language arose, I think, from the absence of a formal education.

FX6 584 I'm telling you all this, and perhaps you don't have to erm pay for any of these treatments we do gift vouchers, so if you've got anybody who wants to buy you a gift of any sort, you could always say well, I fancy erm an eyebrow trim, or I fancy a pedicure perhaps they would like to buy you a gift voucher and then you can come in and it could be a present for you.

G1Y 927 Neither Boswell nor Johnson states Miss McQueen's precise age, but she seems to have passed sufficiently beyond pubescent embarrassment to converse relaxedly with the great Englishman, and Johnson made her a gift of a book, an act of generosity which later caused not a little controversy.

G3A 1303 The Spirit is probably meant by passages of the New Testament which speak of repentance as a gift of God.

G3A 1319 It is the Spirit who takes the things of God and reveals them to us (1 Cor. 2:12), and Paul can rightly say that the very capacity to respond in faith is a gift of God and no man-made attribute of which we can boast (Eph. 2:8).

GT4 653 On this occasion Swift brought him a gift of £20 from Bolingbroke.

GTA 1147 His most important contract (first with another carpenter, John Ball, and then on his own) was for the deepening and wharfing of the Fleet ditch, an enormous task which employed 200 men, took two and a half years to finish (1672–4), and brought him a gift of plate worth £200 from the City on its efficient completion.

GUX 1001 In the bedroom Caterina and Rosalba shared in the apartment in Rupe, smaller than their room in the farmhouse, Rosa questioned her sister, whispering, the night after Tommaso had made her a gift of the bird in the street in sight of everyone coming out of Mass.

HJ4 3152 Meanwhile Joey Dunlop was delighted to receive a gift of a 750cc Honda which he rode today.

HXW 518 But both Lord Hardwicke and Lord Eldon…established extensions of it beyond a simple gift of a chattel by its delivery: the former to a gift of money secured by a bond, by delivery of the bond; the latter to a gift of money secured by a mortgage of land, by delivery of the mortgage deed.

J2B 58 Mrs Sayce marked her retirement this summer by a gift of money for books in Linguistics, Comparative Literature and Modern Languages.

J2B 60 We are grateful to Helen Grant (Newsome, 1927) for a gift of art books and exhibition catalogues, to Dr Ken Lewis for books on genetics, and to Mr Paul Foote for books on Russian Literature.

J6S 576 In particular, a gift of his shares (to a family trust for instance ) is treated as a recovery of capital for these purposes.

JY3 3403 Of all the people in the world to expose her seething mass of fears and insecurities to, Guy Sterne would have been her last choice…yet she'd told him about Mortimer, she'd carelessly made him a gift of her virginity, she'd wildly announced she loved him, and now she was baring her soul over the painful anguish of her mother's death…

K1V 1782 The maharajah offered to make a gift of a well to the village of Stoke Row.

K1Y 2461 And there's a letter which enclosed a gift of 6 salmon flies.

K4W 9358 Young patients at Newcastle's Freeman Hospital will benefit from a gift of £1,120 from 49 probationary Durham police constables who raised the cash with a sponsored swim.

K51 591 He said a gift of modern and useful equipment from a computer to a minibus, sports kit to industrial machinery, was an investment for business.

K5X 52 Oct-11 (clone Thoc 3 in Figure 1) and Oct-2 (full-length cDNA clone, a gift of D.Meijer) coding sequences were introduced into a vector (S.Swift and A.A., unpublished) that contains the protein A gene (32) under the control of a T7 RNA polymerase promoter (33).

K5X 59 The double stranded octamer oligonucleotide (a gift of G.May) was (top strand) 5' GGGCTGATTGATTTGCATGTCCAG 3'.

K97 2010 Mrs Heaton was then presented with a floral arrangement and a gift of a framed print by local artist Jenny Holland.

KA4 209 This seat is now pleased together with a gift of trees to the garden.