Results of your search


Your query was

a gift of

Here is a random selection of 50 solutions from the 110 found.

A68 464 He had a gift of mimicry, and when he made a speech as though he were Asquith or Lloyd George it would raise shouts of laughter.

A7G 276 So a gift of, say £20, will become £26.67 at no added cost to you.

A9J 65 In general, our policy should be to proceed with building our state block by block, without waiting to be given a gift of it through negotiations.

ADC 126 At Corinth St Paul found the phenomenon deeply divisive and productive of censoriousness; he taught the Corinthian church that the authenticity of a gift of the Spirit should be tested by whether or not it contributed to love and edification of the community as a whole.

ADC 305 The ‘world’ was, in terms of nature and by creation, a great good, a gift of the omnipotent and good Creator.

AMT 176 Whereas works were human actions, faith was a gift of grace, a divine action, something implanted in the believer by God — the sort of imagery that Barth refined in his work on Anselm.

AN0 180 Only when Polish intelligence made a gift of its work to GCCS in August 1939 was it able to break its first German messages.

APT 1054 Surprisingly, it was the Nazis who made a gift of this public park to Prague.

ARR 965 On her unlucky nights she really would benefit enormously from a gift of blood.

AYR 442 And as an added incentive you could receive a gift of your choice absolutely free regardless of which savings option you select, if you apply before the 26th July, 1991.

B2G 1440 He or she may be clairvoyant, a medium, or have a gift of telepathy.

B7N 1657 The company sent the editor a gift of a new product, with his name emblazoned all over the top.

BPF 115 Say thank you with a gift of gold from Beaverbrooks.

C8Y 1048 Like all prisoners of circumstance, you will probably reflect a good deal on the whole subject of ‘time’ and of its strange habits of hanging, dragging, or running out too quickly, but if you decide to use and dominate it, instead of allowing it to dominate you, you will inevitably come to the conclusion that it is only wasted if it is thrown away, never when it is offered freely, as a gift of love.

C93 1367 The vicarage was a gift of the Archbishop of York and was built 1869/70.

C96 1156 This was partly the result of a gift of £1 million from the Emir of Kuwait, along with a rise in the number of visitors which has generated around £.5 million.

CBW 3639 The gift of shares was treated as being a transfer of value of the relevant part of the settled property, and therefore no exemption was available as a gift of property to a charity in accordance with para 15(3) (ba), Sch 6, FA 1975, according to the Chancery Division of the High Court in Powell-Cotton v IRC [1992]STI 663.

CD4 435 It is the Holy Spirit at work in our souls, a gift of the divine Love of the Trinity, which enables us to love God with the same love whereby he loves himself.

CG3 1604 Your task is to write a gift of laughter for your friend.

CH2 2189 But a spokesman said last night: ‘A gift of £1 million has also been received from the Emir of Kuwait.

CH7 2133 England No 2 Laurie McMenemy arrived late and missed the Corky and Ferdinand goals — but he saw Deane spurn a gift of an equaliser before finally striking with a header.

CK5 3052 And he's blessed with a gift of a voice that swoops from arcs of strangulated screeching to the huskiest falsetto.

CN1 467 After a combined army of Men and Dwarfs put paid to an Orc invasion at the battle of Black Fire Pass, thus saving the Dwarf realm from destruction, King Kurgan Ironhand showed his gratitude by presenting a gift of magic to the men of the Empire.

CRD 459 In 1949, for example, it emerged before the Lynskey Tribunal that George Gibson, the chairman of the North Western Board, had somewhat unwisely accepted a gift of clothing from the flamboyant contact man, Sidney Stanley.

CRR 135 The laird of Stracathro, from the urgency of his correspondence, was clearly in terror that the land in question might be granted to another, for he was not attempting to secure a gift of the land but offering to pay full market value for it.

CRR 164 Accordingly, it is evident that a gift of such significance could have been of no small value to a freeholder or councillor who would otherwise have found difficulty in endowing a relative so generously at the commencement of his career.

CS7 901 This took the form of a gift of the proceeds from the sale of a hospital farm.

ECF 4827 Somewhat later came the present owner, John Matta, who now takes great pleasure in greeting Citalia guests and welcomes them on arrival with a gift of the wonderful Chianti Classico from his excellent cellars and offers them a typical Tuscan dinner at a reasonable price, which is taken most weeks in the castle's impressive banqueting hall.

EDA 652 The New Party had been funded in January 1931 by a gift of 50,000 from the motor manufacturer William Morris, later Lord Nuffield, and encouraged by defections from the Labour party, including six members of the House of Commons.

EDN 649 She must have that quality, without which no woman could meet his exacting standard, a gift of caring and nurturing, a loving, maternal sweetness.

EED 430 So Murdock received a gift of 20 guineas (£21) but did not have his wages raised.

EX7 157 I had failed a test of faith; faith was a gift of God, yet a gift you must have to live.

FPN 26 He had a mind of quicksilver and a gift of repartee that was second nature; his special love of language arose, I think, from the absence of a formal education.

FPY 1360 Music's place in our services may be seen as a gift of God which he uses to reveal something of himself to us.

G1Y 927 Neither Boswell nor Johnson states Miss McQueen's precise age, but she seems to have passed sufficiently beyond pubescent embarrassment to converse relaxedly with the great Englishman, and Johnson made her a gift of a book, an act of generosity which later caused not a little controversy.

G2R 68 These are available in recognition of a gift of £75 towards the Magdalen Bridge Appeal Fund.

G3A 1303 The Spirit is probably meant by passages of the New Testament which speak of repentance as a gift of God.

G3A 1319 It is the Spirit who takes the things of God and reveals them to us (1 Cor. 2:12), and Paul can rightly say that the very capacity to respond in faith is a gift of God and no man-made attribute of which we can boast (Eph. 2:8).

GT4 653 On this occasion Swift brought him a gift of £20 from Bolingbroke.

GTA 1147 His most important contract (first with another carpenter, John Ball, and then on his own) was for the deepening and wharfing of the Fleet ditch, an enormous task which employed 200 men, took two and a half years to finish (1672–4), and brought him a gift of plate worth £200 from the City on its efficient completion.

H7P 686 and she willingly made a gift of it to her mother in sincere, if perhaps slightly exasperated affection.

H81 134 The court assumes that, if the ground-rent was ‘a burden incident to the taking of the lease’ or (Lord Denman C.J.)‘a necessary burden on the premises,’the plaintiff's promise to pay it would not have been a sufficient consideration: a promise to make a gift of onerous property is still a mere promise to make a gift, though the promisee agrees to assume the burden.

HJ4 3152 Meanwhile Joey Dunlop was delighted to receive a gift of a 750cc Honda which he rode today.

J2B 58 Mrs Sayce marked her retirement this summer by a gift of money for books in Linguistics, Comparative Literature and Modern Languages.

J2B 60 We are grateful to Helen Grant (Newsome, 1927) for a gift of art books and exhibition catalogues, to Dr Ken Lewis for books on genetics, and to Mr Paul Foote for books on Russian Literature.

K5X 52 Oct-11 (clone Thoc 3 in Figure 1) and Oct-2 (full-length cDNA clone, a gift of D.Meijer) coding sequences were introduced into a vector (S.Swift and A.A., unpublished) that contains the protein A gene (32) under the control of a T7 RNA polymerase promoter (33).

K5X 59 The double stranded octamer oligonucleotide (a gift of G.May) was (top strand) 5' GGGCTGATTGATTTGCATGTCCAG 3'.

K97 2010 Mrs Heaton was then presented with a floral arrangement and a gift of a framed print by local artist Jenny Holland.

KA4 209 This seat is now pleased together with a gift of trees to the garden.

KNA 97 And hurrying along on this account that we have here, Ruth, the next morning, she's given a gift by Boaz a a a, a gift of er, to to seal what has been said.