Results of your search


Your query was

a gift of

Here is a random selection of 50 solutions from the 110 found.

A0L 1357 Dawn brings a gift of spider webs flashing diamonds on sea-grey gorse.

ABP 406 A gift of a large sum of money by an infant was after his death held valid.

ADC 126 At Corinth St Paul found the phenomenon deeply divisive and productive of censoriousness; he taught the Corinthian church that the authenticity of a gift of the Spirit should be tested by whether or not it contributed to love and edification of the community as a whole.

ADC 305 The ‘world’ was, in terms of nature and by creation, a great good, a gift of the omnipotent and good Creator.

AMT 244 Where Wesley stressed faith as a gift of God, Locke stressed reason as a gift of God.

ANF 1140 Ehrenburg was convinced that Modi had a gift of prophecy.

APT 1054 Surprisingly, it was the Nazis who made a gift of this public park to Prague.

ARR 965 On her unlucky nights she really would benefit enormously from a gift of blood.

AYR 442 And as an added incentive you could receive a gift of your choice absolutely free regardless of which savings option you select, if you apply before the 26th July, 1991.

BPF 115 Say thank you with a gift of gold from Beaverbrooks.

BPF 199 A Gift of Love

C88 1835 A GIFT of £100 worth of garden tokens was presented to Dr. Christopher Brill by an unseasonal Father Christmas at the Senior Citizens' Luncheon Club last week.

CBW 3639 The gift of shares was treated as being a transfer of value of the relevant part of the settled property, and therefore no exemption was available as a gift of property to a charity in accordance with para 15(3) (ba), Sch 6, FA 1975, according to the Chancery Division of the High Court in Powell-Cotton v IRC [1992]STI 663.

CCN 1815 A gift of story-telling.

CD4 435 It is the Holy Spirit at work in our souls, a gift of the divine Love of the Trinity, which enables us to love God with the same love whereby he loves himself.

CH2 2189 But a spokesman said last night: ‘A gift of £1 million has also been received from the Emir of Kuwait.

CH7 2133 England No 2 Laurie McMenemy arrived late and missed the Corky and Ferdinand goals — but he saw Deane spurn a gift of an equaliser before finally striking with a header.

CHP 187 The greater part of the literature was commissioned from living authors, being either new work for the purpose (in which case they made a gift of the copyright to the Queen), or their own selection from published work.

CM4 909 A gift of gratitude.

CS7 901 This took the form of a gift of the proceeds from the sale of a hospital farm.

EBV 1845 I can see that in such a case they might make a gift of paintings or other works of art for tax reasons, for example, and wouldn't care if they were sold or not.

ECF 4827 Somewhat later came the present owner, John Matta, who now takes great pleasure in greeting Citalia guests and welcomes them on arrival with a gift of the wonderful Chianti Classico from his excellent cellars and offers them a typical Tuscan dinner at a reasonable price, which is taken most weeks in the castle's impressive banqueting hall.

EED 430 So Murdock received a gift of 20 guineas (£21) but did not have his wages raised.

EX7 157 I had failed a test of faith; faith was a gift of God, yet a gift you must have to live.

F9U 709 Minton's largesse was attractive: Bernard still recollects how, at a time when he was earning £2 10s a week, in a timber yard off Greek Street, Minton astonished him with a gift of £10, in effect a month's wages.

FBB 450 It was this regime which sent a gift of 300 horses and five four-horse chariots to Alexander the Great (Diod. xvii.49), and sold off Cyrene's corn to the Greek world in time of shortage (Tod 196).

FD2 84 The dispositive contents of the will include:(i) pecuniary legacies of £1,000 each to the two executors, and of £2,000 to a Mr. Clarke, the deceased's stockbroker;(ii) provision for 150B, High Street and its contents to be retained to provide a residence during their respective lifetimes of two ladies, Mrs. Donelly and Mrs. Willett;(iii) a settled legacy of £10,000 to provide for the maintenance of 150B, High Street during the residence there of the two ladies;(iv) a settled legacy of £2,000 for a specified animal charity; and (v) a gift of residue in equal shares to two specified charities.

FPN 26 He had a mind of quicksilver and a gift of repartee that was second nature; his special love of language arose, I think, from the absence of a formal education.

FPY 1360 Music's place in our services may be seen as a gift of God which he uses to reveal something of himself to us.

G3A 1303 The Spirit is probably meant by passages of the New Testament which speak of repentance as a gift of God.

G3A 1311 When it comes to faith, we are left in no doubt that this is a gift of God brought about by the Holy Spirit.

G3A 1319 It is the Spirit who takes the things of God and reveals them to us (1 Cor. 2:12), and Paul can rightly say that the very capacity to respond in faith is a gift of God and no man-made attribute of which we can boast (Eph. 2:8).

H09 479 As earlier stated a vineyard was always associated with the Palace, in the year 1325, Edward II who when travelling through Kent, was resting at Bokinfold, was sent a gift of wine from the Bishop's vineyard at Halling.

H7P 686 and she willingly made a gift of it to her mother in sincere, if perhaps slightly exasperated affection.

H81 134 The court assumes that, if the ground-rent was ‘a burden incident to the taking of the lease’ or (Lord Denman C.J.)‘a necessary burden on the premises,’the plaintiff's promise to pay it would not have been a sufficient consideration: a promise to make a gift of onerous property is still a mere promise to make a gift, though the promisee agrees to assume the burden.

HDD 359 So wisdom is a gift of the Holy Spirit and that particular thing is to er help us to judge in the way that God does.

HXW 518 But both Lord Hardwicke and Lord Eldon…established extensions of it beyond a simple gift of a chattel by its delivery: the former to a gift of money secured by a bond, by delivery of the bond; the latter to a gift of money secured by a mortgage of land, by delivery of the mortgage deed.

HXW 518 But both Lord Hardwicke and Lord Eldon…established extensions of it beyond a simple gift of a chattel by its delivery: the former to a gift of money secured by a bond, by delivery of the bond; the latter to a gift of money secured by a mortgage of land, by delivery of the mortgage deed.

HXW 520 What has never before been directly decided in England is whether the doctrine applies to a gift of land by delivery of the title deeds…

J6S 677 Assuming the trustees use the loan to acquire Newco shares which they then distribute to employees (relying on the Revenue's press release of 5 December 1990 to ensure the trust does not suffer a capital gains tax charge), they will not be able to repay the borrowings, in which case Newco might as well have made a gift of the necessary funds to the trustees at the outset.

J7D 1194 "supply" is defined in s46 to include:(a) selling, hiring out or lending the goods;(b) entering into a hire-purchase agreement to furnish the goods;(c) the performance of any contract for work and materials to furnish the goods;(d) providing the goods in exchange for any consideration (including trading stamps) other than money;(e) providing the goods in or in connection with the performance of any statutory function; or (f) giving the goods as a prize or otherwise making a gift of the goods.

K1V 1782 The maharajah offered to make a gift of a well to the village of Stoke Row.

K1Y 2461 And there's a letter which enclosed a gift of 6 salmon flies.

K51 591 He said a gift of modern and useful equipment from a computer to a minibus, sports kit to industrial machinery, was an investment for business.

K5X 52 Oct-11 (clone Thoc 3 in Figure 1) and Oct-2 (full-length cDNA clone, a gift of D.Meijer) coding sequences were introduced into a vector (S.Swift and A.A., unpublished) that contains the protein A gene (32) under the control of a T7 RNA polymerase promoter (33).

K5X 59 The double stranded octamer oligonucleotide (a gift of G.May) was (top strand) 5' GGGCTGATTGATTTGCATGTCCAG 3'.

K97 958 Pony a gift of love for sick children

K97 2010 Mrs Heaton was then presented with a floral arrangement and a gift of a framed print by local artist Jenny Holland.

K9A 33 each Sainsbury's, Savacentre and Homebase store will be offering a gift of £250 to under fives groups as part of the Good Neighbour Scheme.

KNA 97 And hurrying along on this account that we have here, Ruth, the next morning, she's given a gift by Boaz a a a, a gift of er, to to seal what has been said.