Results of your search


Your query was

a gift of

Here is a random selection of 50 solutions from the 110 found.

A0L 1357 Dawn brings a gift of spider webs flashing diamonds on sea-grey gorse.

A0P 1849 The reason for the exultation, the explanation of how this sense of craving had been mollified and a sense of sexual peace bestowed on the lyrics was simple: Marianne had come into his arms; that golden apparition of loveliness, that lithe, sensuous, intelligent being of intuition and sympathy; a gift of the gods to rank — and outrank — anything so far told in the surrounding mythology of his adopted Greek homeland!

A9J 65 In general, our policy should be to proceed with building our state block by block, without waiting to be given a gift of it through negotiations.

ADC 126 At Corinth St Paul found the phenomenon deeply divisive and productive of censoriousness; he taught the Corinthian church that the authenticity of a gift of the Spirit should be tested by whether or not it contributed to love and edification of the community as a whole.

ADC 305 The ‘world’ was, in terms of nature and by creation, a great good, a gift of the omnipotent and good Creator.

AMT 244 Where Wesley stressed faith as a gift of God, Locke stressed reason as a gift of God.

AN0 180 Only when Polish intelligence made a gift of its work to GCCS in August 1939 was it able to break its first German messages.

APT 1054 Surprisingly, it was the Nazis who made a gift of this public park to Prague.

ARR 965 On her unlucky nights she really would benefit enormously from a gift of blood.

AYR 442 And as an added incentive you could receive a gift of your choice absolutely free regardless of which savings option you select, if you apply before the 26th July, 1991.

B7N 1657 The company sent the editor a gift of a new product, with his name emblazoned all over the top.

CCN 1815 A gift of story-telling.

CDX 2707 ‘He never once put his hand into his box all the years that I served him,’ meaning he never gave me a gift of money, a bonus for service above and beyond the call of time.

CJF 45 Darren often arrived on their church morning with a gift of flowers.

CK5 3052 And he's blessed with a gift of a voice that swoops from arcs of strangulated screeching to the huskiest falsetto.

CM4 909 A gift of gratitude.

CN1 467 After a combined army of Men and Dwarfs put paid to an Orc invasion at the battle of Black Fire Pass, thus saving the Dwarf realm from destruction, King Kurgan Ironhand showed his gratitude by presenting a gift of magic to the men of the Empire.

CRR 21 When a politician assisted a freeholder with a gift of a patronage appointment, he would almost always give it in the guise of an act of friendship, and it was the friendly relationship which was the truly significant factor.

CRR 135 The laird of Stracathro, from the urgency of his correspondence, was clearly in terror that the land in question might be granted to another, for he was not attempting to secure a gift of the land but offering to pay full market value for it.

CS7 901 This took the form of a gift of the proceeds from the sale of a hospital farm.

EDN 649 She must have that quality, without which no woman could meet his exacting standard, a gift of caring and nurturing, a loving, maternal sweetness.

EED 430 So Murdock received a gift of 20 guineas (£21) but did not have his wages raised.

EEM 779 As a gift of divine origin, there was nothing sacrilegious in their use.

EW9 782 Hope, however, was provided by the offer of a gift of £1,000 from Alderman Ephraim Hallam, to provide leaving scholarships for boys to go on to University.

EW9 1138 A gift of £250 from Sir Alan's will went towards the making of tennis courts, and in due course a Trust Fund was established, of which the School has been a great beneficiary over the years.

EX7 157 I had failed a test of faith; faith was a gift of God, yet a gift you must have to live.

F9U 709 Minton's largesse was attractive: Bernard still recollects how, at a time when he was earning £2 10s a week, in a timber yard off Greek Street, Minton astonished him with a gift of £10, in effect a month's wages.

FNX 1315 On the allotted day, he and Joan arrived at the office for a ten-o'clock wedding, carrying with them a gift of two enormous chairs of the type popular with minor African potentates.

FX6 584 I'm telling you all this, and perhaps you don't have to erm pay for any of these treatments we do gift vouchers, so if you've got anybody who wants to buy you a gift of any sort, you could always say well, I fancy erm an eyebrow trim, or I fancy a pedicure perhaps they would like to buy you a gift voucher and then you can come in and it could be a present for you.

G1Y 340 If Johnson did speak as he wrote — economically, pithily and with a gift of great accuracy — Boswell's Aberdeen observation means that he also sounded beautifully.

G3A 1885 Paradoxically, like so much in the Christian life, unity is a gift of God, and yet we have to work at it.

GT4 653 On this occasion Swift brought him a gift of £20 from Bolingbroke.

GTA 1147 His most important contract (first with another carpenter, John Ball, and then on his own) was for the deepening and wharfing of the Fleet ditch, an enormous task which employed 200 men, took two and a half years to finish (1672–4), and brought him a gift of plate worth £200 from the City on its efficient completion.

GU7 432 Where photographs can show things invisible to the unaided eye, they are extremely valuable; and in the second half of the nineteenth century the camera, a gift of science to society, could be a useful scientific instrument.

GUX 1001 In the bedroom Caterina and Rosalba shared in the apartment in Rupe, smaller than their room in the farmhouse, Rosa questioned her sister, whispering, the night after Tommaso had made her a gift of the bird in the street in sight of everyone coming out of Mass.

GX7 518 The school was also very grateful for a gift of text books which Philip presented on behalf of LASMO North Sea.

H09 479 As earlier stated a vineyard was always associated with the Palace, in the year 1325, Edward II who when travelling through Kent, was resting at Bokinfold, was sent a gift of wine from the Bishop's vineyard at Halling.

H81 134 The court assumes that, if the ground-rent was ‘a burden incident to the taking of the lease’ or (Lord Denman C.J.)‘a necessary burden on the premises,’the plaintiff's promise to pay it would not have been a sufficient consideration: a promise to make a gift of onerous property is still a mere promise to make a gift, though the promisee agrees to assume the burden.

HJ4 3152 Meanwhile Joey Dunlop was delighted to receive a gift of a 750cc Honda which he rode today.

HTN 1420 I made a gift of them to the lad, didn't I?

HXX 1397 A crown now on the head of a Madonna in Essen may be that of the child Otto III, while another on the head of a crucifix in Vercelli has been thought a gift of his.

J2B 58 Mrs Sayce marked her retirement this summer by a gift of money for books in Linguistics, Comparative Literature and Modern Languages.

J6S 576 In particular, a gift of his shares (to a family trust for instance ) is treated as a recovery of capital for these purposes.

J6S 677 Assuming the trustees use the loan to acquire Newco shares which they then distribute to employees (relying on the Revenue's press release of 5 December 1990 to ensure the trust does not suffer a capital gains tax charge), they will not be able to repay the borrowings, in which case Newco might as well have made a gift of the necessary funds to the trustees at the outset.

K1Y 2461 And there's a letter which enclosed a gift of 6 salmon flies.

K5X 52 Oct-11 (clone Thoc 3 in Figure 1) and Oct-2 (full-length cDNA clone, a gift of D.Meijer) coding sequences were introduced into a vector (S.Swift and A.A., unpublished) that contains the protein A gene (32) under the control of a T7 RNA polymerase promoter (33).

K5X 59 The double stranded octamer oligonucleotide (a gift of G.May) was (top strand) 5' GGGCTGATTGATTTGCATGTCCAG 3'.

K97 2010 Mrs Heaton was then presented with a floral arrangement and a gift of a framed print by local artist Jenny Holland.

K9A 33 each Sainsbury's, Savacentre and Homebase store will be offering a gift of £250 to under fives groups as part of the Good Neighbour Scheme.

KNA 97 And hurrying along on this account that we have here, Ruth, the next morning, she's given a gift by Boaz a a a, a gift of er, to to seal what has been said.