Results of your search


Your query was

a gift of

Here is a random selection of 50 solutions from the 110 found.

A0L 1357 Dawn brings a gift of spider webs flashing diamonds on sea-grey gorse.

A0P 1849 The reason for the exultation, the explanation of how this sense of craving had been mollified and a sense of sexual peace bestowed on the lyrics was simple: Marianne had come into his arms; that golden apparition of loveliness, that lithe, sensuous, intelligent being of intuition and sympathy; a gift of the gods to rank — and outrank — anything so far told in the surrounding mythology of his adopted Greek homeland!

ADC 126 At Corinth St Paul found the phenomenon deeply divisive and productive of censoriousness; he taught the Corinthian church that the authenticity of a gift of the Spirit should be tested by whether or not it contributed to love and edification of the community as a whole.

ADC 305 The ‘world’ was, in terms of nature and by creation, a great good, a gift of the omnipotent and good Creator.

AMT 176 Whereas works were human actions, faith was a gift of grace, a divine action, something implanted in the believer by God — the sort of imagery that Barth refined in his work on Anselm.

AMT 244 Where Wesley stressed faith as a gift of God, Locke stressed reason as a gift of God.

AND 798 A family service guaranteed to pack the school hall is a mothers' day assembly particularly if mums, including teachers, receive a gift of a small posy of spring flowers.

APT 1054 Surprisingly, it was the Nazis who made a gift of this public park to Prague.

ARR 965 On her unlucky nights she really would benefit enormously from a gift of blood.

AYR 442 And as an added incentive you could receive a gift of your choice absolutely free regardless of which savings option you select, if you apply before the 26th July, 1991.

BPF 115 Say thank you with a gift of gold from Beaverbrooks.

C88 1835 A GIFT of £100 worth of garden tokens was presented to Dr. Christopher Brill by an unseasonal Father Christmas at the Senior Citizens' Luncheon Club last week.

C8Y 1048 Like all prisoners of circumstance, you will probably reflect a good deal on the whole subject of ‘time’ and of its strange habits of hanging, dragging, or running out too quickly, but if you decide to use and dominate it, instead of allowing it to dominate you, you will inevitably come to the conclusion that it is only wasted if it is thrown away, never when it is offered freely, as a gift of love.

C93 1367 The vicarage was a gift of the Archbishop of York and was built 1869/70.

C96 1156 This was partly the result of a gift of £1 million from the Emir of Kuwait, along with a rise in the number of visitors which has generated around £.5 million.

C9S 1250 who believed that ‘human sexuality in all its richness is a gift of God gladly to be accepted, enjoyed and honoured, as a way of both expressing and growing in love, in accordance with the life and teaching of Jesus Christ.’

CBW 3639 The gift of shares was treated as being a transfer of value of the relevant part of the settled property, and therefore no exemption was available as a gift of property to a charity in accordance with para 15(3) (ba), Sch 6, FA 1975, according to the Chancery Division of the High Court in Powell-Cotton v IRC [1992]STI 663.

CDX 2707 ‘He never once put his hand into his box all the years that I served him,’ meaning he never gave me a gift of money, a bonus for service above and beyond the call of time.

CG3 1604 Your task is to write a gift of laughter for your friend.

CH2 2189 But a spokesman said last night: ‘A gift of £1 million has also been received from the Emir of Kuwait.

CHP 187 The greater part of the literature was commissioned from living authors, being either new work for the purpose (in which case they made a gift of the copyright to the Queen), or their own selection from published work.

CJF 45 Darren often arrived on their church morning with a gift of flowers.

CM4 909 A gift of gratitude.

CRR 164 Accordingly, it is evident that a gift of such significance could have been of no small value to a freeholder or councillor who would otherwise have found difficulty in endowing a relative so generously at the commencement of his career.

CRR 494 Political intervention was advisable even when an applicant had the necessary financial strength to make a purchase, and if a gift of a commission was a greater compliment, permission to purchase was nonetheless gratefully accepted.

CS7 901 This took the form of a gift of the proceeds from the sale of a hospital farm.

EBV 1845 I can see that in such a case they might make a gift of paintings or other works of art for tax reasons, for example, and wouldn't care if they were sold or not.

EDA 652 The New Party had been funded in January 1931 by a gift of 50,000 from the motor manufacturer William Morris, later Lord Nuffield, and encouraged by defections from the Labour party, including six members of the House of Commons.

EDN 649 She must have that quality, without which no woman could meet his exacting standard, a gift of caring and nurturing, a loving, maternal sweetness.

EEW 2016 But I would consider it a great honour and privilege if you would allow me to help you overcome this disadvantage by making you a gift of whatever you may need.’

FPN 26 He had a mind of quicksilver and a gift of repartee that was second nature; his special love of language arose, I think, from the absence of a formal education.

FPY 1360 Music's place in our services may be seen as a gift of God which he uses to reveal something of himself to us.

G1Y 927 Neither Boswell nor Johnson states Miss McQueen's precise age, but she seems to have passed sufficiently beyond pubescent embarrassment to converse relaxedly with the great Englishman, and Johnson made her a gift of a book, an act of generosity which later caused not a little controversy.

G3A 1303 The Spirit is probably meant by passages of the New Testament which speak of repentance as a gift of God.

G3A 1319 It is the Spirit who takes the things of God and reveals them to us (1 Cor. 2:12), and Paul can rightly say that the very capacity to respond in faith is a gift of God and no man-made attribute of which we can boast (Eph. 2:8).

H7P 686 and she willingly made a gift of it to her mother in sincere, if perhaps slightly exasperated affection.

H81 134 The court assumes that, if the ground-rent was ‘a burden incident to the taking of the lease’ or (Lord Denman C.J.)‘a necessary burden on the premises,’the plaintiff's promise to pay it would not have been a sufficient consideration: a promise to make a gift of onerous property is still a mere promise to make a gift, though the promisee agrees to assume the burden.

H84 601 ‘I do not know why I even trust you, but I have no men trained to use their hearts in the way you are able to as a gift of Ptah.

HDD 359 So wisdom is a gift of the Holy Spirit and that particular thing is to er help us to judge in the way that God does.

HJ4 3152 Meanwhile Joey Dunlop was delighted to receive a gift of a 750cc Honda which he rode today.

HLJ 1106 On his return to Cambodia on April 17 Sihanouk announced that China had provided a gift of US$1,800,000 to the SNC.

HXW 518 But both Lord Hardwicke and Lord Eldon…established extensions of it beyond a simple gift of a chattel by its delivery: the former to a gift of money secured by a bond, by delivery of the bond; the latter to a gift of money secured by a mortgage of land, by delivery of the mortgage deed.

J2B 58 Mrs Sayce marked her retirement this summer by a gift of money for books in Linguistics, Comparative Literature and Modern Languages.

J6S 576 In particular, a gift of his shares (to a family trust for instance ) is treated as a recovery of capital for these purposes.

K1Y 2461 And there's a letter which enclosed a gift of 6 salmon flies.

K4W 9358 Young patients at Newcastle's Freeman Hospital will benefit from a gift of £1,120 from 49 probationary Durham police constables who raised the cash with a sponsored swim.

K51 591 He said a gift of modern and useful equipment from a computer to a minibus, sports kit to industrial machinery, was an investment for business.

K5X 52 Oct-11 (clone Thoc 3 in Figure 1) and Oct-2 (full-length cDNA clone, a gift of D.Meijer) coding sequences were introduced into a vector (S.Swift and A.A., unpublished) that contains the protein A gene (32) under the control of a T7 RNA polymerase promoter (33).

K5X 59 The double stranded octamer oligonucleotide (a gift of G.May) was (top strand) 5' GGGCTGATTGATTTGCATGTCCAG 3'.

K9D 744 SCORES of children cheered the arrival at their school of a gift of a minibus — presented by a Courtaulds company to mark a quality achievement.